Introduction
Bread wheat (Triticum
aestivum) is one of the staple food crops and consumed by ≥ 30% of
the world as a main nutrient source (IWGSC 2014). Common wheat is composed of
three different genomes (A, B and D) which characterize its allohexapolyploid
nature (Son et al. 2020). Wheat was
first cultivated from 10,000 years ago during a time called the ‘Neolithic
revolution’ (Avni et al. 2017). At
this time, einkorn (2x, AA) and emmer (4X, AABB)
wheats were cultivated, and they are believed to have originated from the
south-eastern regions of Turkey (Nesbitt 1998; Petersen et al. 2006; Avni et al.
2017). Bread wheat arose about 9000 years ago, and it was originated by natural
hybridization of emmer with Aegilops
species (Aegilops tauschii and Ae. Squarosa) (IWGSC 2014). Wheat cultivation
spread in Korea during 1st and 2nd century BC through
China (Crawford 2011).
The semi-dwarfing gene
(Rht), leading to the “Green
revolution”, is known to have been transmitted from Asian wheat (Korean or
Japanese wheat landraces) (Hedden 2003). The mutant allele of the dwarfing gene
was associated with yield increases (by 24%) and disease resistance, thus, over
the 70% of wheat cultivars grown world-wide may have this mutant allele
(Casebow et al. 2016). The Rht gene was consists to Rht1 (or RhtB1) and Rht2 (or RhtD1) which are located on chromosome
4B and 4D, respectively. Dwarfing genes encode DELLA proteins that inhibit
plant growth while gibberellic acid (GA) promotes plant growth (Shin et al. 2014; Son et al. 2020).
Ellis et al. (2002) developed
molecular markers to identify of Rht1
and Rht2. Using these markers, wheat
can be selected with reduced stem length up to 15% (Gale and Youssefian 1985;
Flintham et al. 1997).
Three hundred and nine
wheat landraces (6X, AABBDD) have been collected in Korea, which are a useful
gene pool for the national wheat breeding program. Especially, for common
wheat, no clear ancestors are known for common wheat, making this gene pool
more useful (Kihara 1944; McFadden and Sears 1946). In Korea, 40 wheat
cultivars have been developed by crossing of various wheat lines containing
Korean landraces and some cultivars from other countries (Son et al. 2020). Consequently, some of the
important traits of the landraces may be very crucial to run a successful
breeding program for wheat.
Microsatellites
containing simple sequence repeat (SSR) and inter simple repeat (ISSR) markers
can be easily assayed for polymorphism using polymerase chain reaction (PCR) (Ahmad
et al. 2019). In particular, a
microsatellite, compared to other molecular marker types, has the advantage and
useful as a co-dominant marker in the early generation of genetic separation as
a co-dominant marker (Temnykh et al.
2000; Jaiswal et al. 2017). Clear
polymorphisms can be identified compared to a restriction fragment length
polymorphism (RFLP) and random amplification of polymorphic DNA (RAPD). These markers
made it can clearly explain diversity of wheat. Because of the potential for
microsatellites as molecular markers, Roder et
al. (1995) investigated microsatellites in bread wheat. Such microsatellite
or ISSRs have been used for analyzing the relationship between the species of
wheat as well as gene mapping, and they were used for marker development
associated with specific traits (Varshney et
al. 1998; Ahmad et al. 2019;
Howell et al. 2020).
In this study, we
analyzed the relationship among Korean wheat landraces using microsatellites to
confirm their genetic association and morphological characteristics so that
they can be used in future breeding program.
Materials and Methods
Plant materials
and morphological evaluation
The materials
for this study consisted of 171 accessions containing Chinese spring and 170
Korean wheat landraces collected from different areas of Korea. One hundred
seventy landraces were provided by the National Agrobiodiversity Center in the
National Academy of Agricultural Science of Rural Development Administration
(Jeonju, Korea) and were selected from 309 landraces. The agricultural traits
such as stem length and heading date were evaluated following Agricultural
Science and Technology Survey Analysis Standard (RDA 2012).
DNA isolation
and PCR amplification
The young leaves were detached from plant and frozen immediately into
liquid nitrogen and then leaf samples were grinded into powder using a plastic
grinder. Two hundred (200) mg of grinded samples was taken to extract genomic
DNA using a plant genomic DNA prep kit (Biofact, Korea). The extracted genomic
DNA was quantified using a Nanodrop 1000 spectrophotometer (Thermo Scientific,
Wilmington, U.S.A.). For the PCR amplification, the Veriti® Dx 96-Well Thermal
Cycler (Applied Biosystem, USA) was used. PCR amplification was done with 1
unit of Taq polymerase (i-star maxII, Korea), 100 ng genomic DNA, 1× PCR
buffer, 0.5 μM primer, 200 μM and dNTPs in a total
volume of 25 μL. PCR reactions were 35 cycles of 94°C for 30 s,
50-60°C for 30 s, and 72°C for 1 min. The PCR product was electrophoresed at
100V for 0.5–1 h with a 1.5% agarose gel and using a QIAxcel auto electrophoresis
machine (Qiagen, U.S.A.).
The PCR reaction for the Rht gene was performed using the following oligonucleotide primers,
as reported by Ellis et al. (2002):
B1aF, GGTAGGGAGGCGAGAGGCGAG; B1aR, CATCCCCATGGCCATCTCGAGCTG; B1bF,
GGTAGGGAGGCGAGAGGCGAG; B1bR, CATCCCCATGGCCATCTCGAGCTA; D1aF,
GGCAAGCAAAAGCTTCGCG; D1aR, GGCCATCTCGAGCTGCAC; D1bF, CGCGCAATTATTGGCCAGAGATAG;
D1bR, CCCCATGGCCATCTCGAGCTGCTA. The PCR reactions were as follows: 35 cycles of
94°C for 30 s, 58°C for 30 s, and 72°C for 1 min. The PCR reactions and gel
product were obtained as described in above paragraph. Three of the landraces
were not amplified in RhtB1 and RhtD1,
so they were not included in the results of the Rht analysis.
Statistical
and phylogenetic relationship analysis
The presence or
absence of SSR and ISSR bands in the result of electrophoresis results were
recorded as a binary code 1 or 0, which was used for the phylogenetic analysis
of the accessions. Polymorphism information content was
calculated using the formula PIC = 1- (Liu 1998). All analysis of the
genetic diversity and phylogenetic relationship and principle component
analysis (PCA) were performed using the R software (R-3.5.1). The R project for statistical computing, https://www.rproject.org).
The dendrogram was built by using the unweighted pair-group method and
"dist" function in R with the option of "binary", the genetic data were calculated the distance from each sample.
And The "hclust" function was used to merge
each sample distance with the option of Ward. That data was visualized by
"plot" function and to make rount shape, "fan" option was
used. The PCA analysis was performed by "prcomp" function in R. That
function printed the eigen value and eigen vector from
the SSR polymorphism data that converted the number (0, 1). The point colors
were mapped to the distribution by the result of phylogenic tree group.
Results
Agricultural characteristics
of Korean landrace wheat
Table 1: Summary of the agricultural characteristics of the Koran
wheat landraces
|
Heading date (mm.dd) |
Stem length |
Length of spike |
Awn length |
No. of grain |
No. of tiller |
1000 grain weight (g) |
Average |
4.14 |
102.2 |
9.3 |
5.0 |
17.1 |
7.6 |
34.9 |
Standard error |
± 4.6 day |
± 1.53 |
± 0.09 |
± 0.14 |
± 0.13 |
± 0.24 |
± 0.57 |
Table 2: Primers used in
the current study and their genetic diversity
|
Forward sequence |
Reverse sequence |
Repeat motif (N)n |
Type |
PIC |
No. of |
Ae |
I |
h |
Xgwm356 |
CCAATCAGCCTGCAACAAC |
AGCGTTCTTGGGAATTAGAGA |
SSR |
0.38 |
2 |
1.507 |
0.519 |
0.336 |
|
Gwm268 |
TTATGTGATTGCGTACGTACCC |
AGGGGATATGTTGTCACTCCA |
SSR |
0.99 |
2 |
1 |
0 |
0 |
|
Gwm291 |
AATGGTATCTATTCCGACCCG |
CATCCCTAGGCCACTCTGC |
SSR |
0.99 |
18 |
6.237 |
0.22 |
0.839 |
|
Gwm293 |
TCGCCATCACTCGTTCAAG |
TACTGGTTCACATTGGTGCG |
SSR |
0 |
1(all) |
1 |
0 |
0 |
|
Xgwm294 |
GCAGAGTGATCAATGCCAGA |
GGATTGGAGTTAAGAGAGAACCG |
SSR |
0.99 |
8 |
3.987 |
1.598 |
0.749 |
|
Xgwm295 |
GTGAAGCAGACCCACAACAC |
GACGCCTGCGACGTAGAG |
SSR |
0.99 |
2 |
3.027 |
1.27 |
0.669 |
|
Gwm325 |
TTTTTACGCGTCAACGACG |
TTTCTTCTGTCGTTCTCTTCCC |
SSR |
0.99 |
1 |
1.046 |
0.11 |
0.044 |
|
Xwmc407 |
CATATTTCCAAATCCCCAACTC |
GGTAATTCTAGGCTGACATATGCTC |
SSR |
0.99 |
5 |
1.348 |
0.551 |
0.258 |
|
Gwm484 |
AGTTCCGGTCATGGCTAGG |
ACATCGCTCTTCACAAACCC |
SSR |
0.97 |
7 |
5.01 |
1.75 |
0.8 |
|
Wmc527 |
GCTACAGAAAACCGGAGCCTAT |
ACCCAAGATTGGTGGCAGAA |
SSR |
0.99 |
3 |
2.933 |
1.234 |
0.659 |
|
Xcfa2129 |
ATCGCTCACTCACTATCGGG |
GTTGCACGACCTACAAAGCA |
SSR |
0 |
1(all) |
1 |
0 |
0 |
|
BE585744 |
GCTATGGCATTCCTCAGCTC |
GCCCAAGCCATATCTATCCA |
SSR |
0.99 |
1 |
1 |
0 |
0 |
|
gwm133 |
ATCTAAACAAGACGGCGGTG |
ATCTGTGACAACCGGTGAGA |
SSR |
0.98 |
4 |
3.064 |
1.419 |
0.673 |
|
gwm493 |
TTCCCATAACTAAAAACCGCG |
GGAACATCATTTCTGGACTTTG |
SSR |
0.48 |
6 |
1.861 |
1.032 |
0.462 |
|
wmc156 |
GCCTCTAGGGAGAAAACTAACA |
TCAAGATCATATCCTCCCCAAC |
SSR |
0.99 |
3 |
1.536 |
0.641 |
0.349 |
|
ISSR807 |
AGAGAGAGAGAGAGAGT |
(AG)8T |
ISSR |
0.07 |
2 |
1.077 |
0.159 |
0.072 |
|
ISSR808 |
AGAGAGAGAGAGAGAGC |
(AG)8G |
ISSR |
0.92 |
11 |
2.66 |
1.292 |
0.624 |
|
ISSR810 |
GAGAGAGAGAGAGAGAT |
(GA)8T |
ISSR |
0.89 |
5 |
4.5 |
1.56 |
0.777 |
|
ISSR815 |
CTCTCTCTCTCTCTCTG |
(CT)8G |
ISSR |
0.95 |
7 |
4.154 |
1.739 |
0.759 |
|
ISSR824 |
TCTCTCTCTCTCTCTCG |
(TG)8G |
ISSR |
0.97 |
2 |
8.727 |
0.601 |
0.885 |
|
ISSR827 |
ACACACACACACACACG |
(AC)8G |
ISSR |
0.99 |
9 |
1.664 |
0.834 |
0.399 |
|
ISSR835 |
AGAGAGAGAGAGAGAGYC |
(AG)8YC |
ISSR |
0 |
3(all) |
1 |
0 |
0 |
|
ISSR841 |
GAGAGAGAGAGAGAGAYC |
(GA)8YC |
ISSR |
0 |
2(all) |
1 |
0 |
0 |
|
ISSR842 |
GAGAGAGAGAGAGAGAYG |
(GA)8YG |
ISSR |
0.99 |
8 |
4.28 |
1.601 |
0.766 |
|
ISSR848 |
CACACACACACACACARG |
(CA)8RG |
ISSR |
0.98 |
12 |
1.304 |
0.395 |
0.233 |
PIC; polymorphism information content, Ae; Number of
effective alleles, I; Shannon's
information index, h; Nei's gene diversity
Stem length, heading date and 1000 grain weight (TGW) of the landraces
were investigated according to the agricultural science and technology survey
analysis standard (RDA 2012). Agronomic characteristics of these landraces
varied widely for stem length (SL), number of grains per spike and TGW varied
widely (Fig. 1). The stem length (SL) varied from 54 to 152 cm, and the average
length was 102.2 cm. Wheat landraces with stem lengths less than 60 cm were
identified as two strains, 60 cm to 69 cm as five, 70 cm to 90 cm as 48, and
over 90 cm as 115. The average number of grains per spike varied from 12.2 to
22.7 (average 17.1). The average heading date was April 15, TGW was 18.9 g to
53.2 g, and the average was 34.9 g. The average lengths of the spike (LS) and
awn length (AL) were 9.3 cm and 5.0 cm, respectively, and the average number of
tiller (NT) was 7.6 (Table 1).
Result of the PCR
amplification for SSR and ISSR markers
The 25 primers showed consistent amplification among the analyzed
resources and 13 primers consisted of a 3’-end anchoring ISSR primer. Each
primer set produced from 1 to 20 detectable amplified bands and their size
ranged from 100 to 2000 bp. Although major bands were reproduced in the
repeated reactions, some minor and faint bands were inconsistent, which were
excluded from further analysis. Polymorphisms were observed among the different
Korean landraces. The 12 SSR and 13 ISSR markers generated 2821 polymorphic
bands available for phylogenetic analysis, corresponding to an average of 3.48
polymorphic bands per primer. The polymorphism information content (PIC) of the
primers was over the 0.95 except for eight primers. Twenty-one markers detected
variable polymorphisms in all the resources, but four markers, Gwm293,
Xcfa2129, ISSR835 and ISSR841, were amplified equally in all resources. Three
markers, Xgwm356, Gwm493 and ISSR807, showed had a low PIC of 0.38, 0.48 and
0.07, respectively (Table 2).
Genetic diversity analysis of the
Korean wheat landraces
Spurious minor bands were excluded
from this analysis to obtain a robust phylogenetic relationship among the 170 Korean
landraces, and a total of 2821 polymorphic bands were used. The clustering
pattern revealed that the resources were categorized into five major groups.
Group I to V contained 30, 35, 25, 55 and 26 lines, respectively. Six wheat
landraces, IT159752 (group I), IT159762 (group I), IT151032 (group II),
IT151044 ((group II), IT151048 (group III) and IT151049 (group III) had the
same genotypes. Chinese spring was used as an outgroup,
but it also clustered with the Korean landraces (Fig. 2A).
The PCA of the profiles
of the 170 landraces showed the distribution and to provide a board visual
comparison. In addition, it was performed to compare the main components and
agricultural characteristics among the wheat landraces. PC1 and PC2 accounted
for the low of variance (6.55 and 5.74%, respectively). PC1 was closely related
single kernel trait of wheat, and PC2 was related to both tillers per plant
trait and 808 ISSR polymorphisms. Although most of the landraces showed
differences, some of the landraces were grouped in the plot. Almost all of the
landraces among group I, III and IV clustered. The landraces of group I are on
the left-hand side and low on the PCA plot (i.e.,
PC1 and PC2 were negative), and the landraces of group III and IV are on the
right-hand side of the PCA plot (i.e.,
PC1 was positive). This result was similar with the dendrogram (Fig. 2A, 2C).
Fig. 1: Distribution
of the agricultural traits of the Korean wheat landraces. This graph indicates
the numerical range of each trait. A;
stem length, B; number of grain per
spike, C; 1000 grain weight
Fig. 2: Analysis of
the phylogenetic relationship and genetic diversity of the 170 collected Korean
wheat landraces. A;
Dendrogram, B;
distribution of the collection regions of the Korean wheat landraces.
Each spots represents each group, and size shows some number of the landraces, C; PCA analysis of the profiles
obtained by the polymorphic bands of the SSRs and ISSRs, D; Distribution of stem length of Korean wheat landraces by each
group
The stem length of the lines was various. The average
stem length of Group I and V was 104.8 and 108.9 cm, respectively, which are
taller than groups II, III and IV (Fig. 2D, Table 3). Additionally, 45 of the 56 resources
among group I and V were collected in the regions near west coast and southeast
coast of Korea. Nine excluded wheat resources belong to group V, which were
collected in the same region near the southeastern inland of Korea. Most of the
resources among groups II, III and IV are located in near the west and south
coast, and the other resources were wheat collected from the near the west,
south sea and central inland region of Korea (Fig. 2B).
Distribution of the Rht gene
The RhtB1a allele was
amplified in 127 and the Rht-B1b allele
in 31 of 170 landraces, respectively. Ten landraces have both the RhtB1a and RhtB1b alleles. The RhtD1a
and RhtD1b alleles were identified in
129 and 38 landraces, respectively. It was identified that the RhtB1a allele was together with RhtD1b, and the RhtB1b allele was coupled with the RhtD1a, respectively. Ten landraces (RhtB1a/RhtB1b) were only
coupled with RhtD1a allele. It is
interesting that no landraces have both RhtB1b
and RhtD1b.
The stem length of the 170 Korean wheat landraces was
102.2 cm. The stem length of the landraces containing the RhtB1a allele was 103.80
cm on average the RhtB1b allele
averaged 91.70 cm; the RhtD1a allele
averaged 105.80 cm, and the RhtD1b
allele averaged 89.55 cm, respectively (Table 4). The stem length of 10
landraces was the longest with an average of 114.3 cm compared with the other
genotypes. However, other agricultural traits, LS, AL, NT and TGW did not show
any significant differences for allele composition of the Rht genes (Fig. 3). The mean number of effective alleles (Ae), Shannon’s information index (I) and Nei’s gene diversity of the RhtB1b and RhtD1b alleles of the Korean landraces showed high scores. These
were 30.072 (Ae), 0.310 (h) and 0.966 (I) for RhtB1b and 20.013
(Ae), 0.334 (h) and 0.950 (I) for RhtD1b, respectively. The RhtD1a alleles had a lower Ae (1.710) and genetic diversity (0.205
for I and 0.415 for h values) compared with the other
alleles (Table 4).
Table 3: Characteristics of each group in the analysis of the
phylogenetic relationship
Groups |
No. of lines |
Average of stem length (cm) |
Standard error |
Group 1 |
30 |
104.8 |
± 3.87 |
Group 2 |
35 |
99.1 |
± 4.31 |
Group 3 |
25 |
99.8 |
± 5.30 |
Group 4 |
55 |
96.6 |
± 2.87 |
Group 5 |
26 |
108.9 |
± 3.40 |
Chines spring was
group 1
Table 4: Summary of the genetic diversity of the Rht gene in the
Korean wheat landraces
Allele |
No. of |
Type |
Ne |
I |
h |
Stem length (cm) |
Average ± SE |
||||||
RhtB1a |
127 |
wild |
1.820 |
0.221 |
0.450 |
103.80±1.58 |
RhtB1b |
31 |
dwarf |
30.072 |
0.310 |
0.966 |
91.70±2.96 |
RhtD1a |
129 |
wild |
1.710 |
0.205 |
0.415 |
105.80±1.82 |
RhtD1b |
38 |
dwarf |
20.013 |
0.334 |
0.950 |
89.55±1.79 |
Ne; number of
effective alleles, I; Shannon's
information index, h; Nei's gene diversity, SE; Standard error. Non amplified three lines and
10 lines containing both RhtB1a and RhtB1b alleles equally were excepted in
this data
Fig. 3: Agricultural characteristics of the landraces according
to the composition of the Rht allele. RhtB1b
allele data were same with the total. SL; stem length, LS; length of spike, AL;
awn length, NGS; number of grains per spike, NT; number of tiller, TGW; 1000
grain weight
Discussion
Wheat is one of the most important but in Korean wheat is a
supplementary crop. However, Korean wheat consumption has increased rapidly
(Son et al. 2020). The collected
wheat used in this study was allohexapolyploid (AABBDD) wheat and
it is thought that the improved wheat from China has propagated in Korea
indicating it was not originated from Korea, previous reports also suggest that
the origin of wheat was from southeastern Turkey (Heun et al. 1997;
Nesbitt 1998; Dubcovsky and Dvorak 2007). The Korean landraces were evenly
collected over the whole Korea to present the geographic characteristics of
whole Korea including the location of the carbonized seeds (Kim 2013). These
landraces were genetically
different except for a few traits. Genetic diversity in this set of landraces
is advantageous for developing the new wheat varieties.
Microsatellite DNAs have been used in various plant to analyze genetic diversity or phylogenetic
relationship (Ahmad et al. 2019; Chen
et al. 2019; He et al. 2019). Molecular marker techniques are utilized in elite
wheat breeding processes for DNA fingerprinting, marker assisted breeding
(MAS), and quantitative trait loci (QTLs) analysis (Lee et al. 2012). In this study, we used SSRs and ISSRs equally in the
analysis of the phylogenetic relationship of Korean
traditional wheat. We used two kinds of marker datasets at the same time,
because this method was thought to enable a complementary role in many
polymorphic band identification and phylogenetic analysis. Phylogenetic
analysis of wheat was also attempted using barcoding DNA containing nuclear and
chloroplast DNA (Dizkirici et al.
2013). In addition, the nucleotide sequence of the wheat was decoded, and an
evolutionary analysis was performed for a comparative phylogenetic analysis by
analyzing the genetic material of each sub-genome A, B and D of wheat
(Hadzhimateva et al. 2015).
Phylogenetic analysis of wheat landraces was attempted in Kazakhstan. Landraces
were analyzed using an SNP array and compared with local location (Turuspekov et al. 2015). The landraces used in this
study were also found to be closely related to the geographical characteristics
of Korea. Their genetic and phenotypic characteristics
of the Korean wheat landraces were very diverse, and the collection areas of
the wheat belonged to each group. PCA analysis is slightly similar to
phylogenetic relationship and data analysis using the SSRs and ISSRs in
combination can be trustworthy. It was expected that the genetic
characteristics of wheat in the inland and coastal areas were far apart, and
the genetic distance of wheat near the coast was close. This was presumably
because of the geographical characteristics of Korea: the plains in the
southwest, and the high zones and mountain ranges in the east.
Because Rht
gene was expected to have been transmitted from Korean or Japanese wheat
varieties, it is very important as the gene that could solve the world’s food
shortage problem. Rht-1 dwarfing alleles are related to stem length and
wheat productivity (Son et al. 2020).
Although various alleles of the Rht-1
gene have been reported however, RhtB1b and RhtD1b alleles are
mutants related to reducing the stem length and increase the lodging resistance
and yield productivity (Casebow et al.
2016; Rasheed et al. 2016). It has been reported that the RhtB1a and RhtD1a alleles were related to longer
stems (Ellis et al. 2002). Most of the Korean wheat landraces had the RhtB1a and RhtD1a alleles, and most of these lines had a longer stem length.
The mutant alleles, RhtB1b and RhtD1b, were rarely seen (17–22%,
respectively) in the landraces, and these alleles showed a high correlation
with a short stem length. Our results supported by previous report that about
45% of wheat has the RhtB1b allele, and most wheat varieties have RhtD1a
(Wurschum et al. 2017). However, 10 landraces were heterozygous and
having both alleles RhtB1a and RhtB1b equally indicating the unique
characteristic of Korean wheat landraces. It also differed from previous
reports on the Rht-1 gene using
modern wheat lines; thus, further research is necessary. The stem length of
wheat with RhtB1b and RhtD1b at the same time was shorter than
that of the wild type of Rht. We also
indicate that RhtD1b is
a recessive gene (Son et al. 2020),
therefore, so we also speculated that this gene was transmitted from Asian
wheat to the global wheat germplasm. However, further research into this gene
is necessary to utilize in future breeding programs.
Conclusion
Korean wheat landraces showed high polymorphism and genetic diversity.
Except for 6 lines, all 164 lines showed different genetic characteristics. Rht gene analysis revealed a specific
distribution of alleles. Most of the landraces had the wild type gene; in
contrast, both the RhtB1b and RhtD1b alleles were identified only in
31 and 38 landraces, respectively. Because the results of the Rht
analysis differ from the existing theories, the relationship between the
diversity of the Rht genes and
phenotype needs to be studied further. In addition, many Korean wheat landraces containing genetic diversity
analyzed in this study are expected to be useful for the development of Korean
wheat varieties.
Acknowledgements
This work was carried out with the support of Cooperative Research
Program for Agriculture Science and Technology Development (Project No. PJ013159032020), Rural Development Administration, Republic of
Korea.
Author Contributions
Conceptualization, JHS, CK and C-SK; Methodology, J-HS,
JC and JY; Software, CK, JC and CC; Validation. K-HK, K-MK and H-YJ; Investigation,
J-HS and C-SK; Data curation, Y-MY, Y-JK and JP; Project
administration, T-IP and C-SK; Writing-original draft preparation, J-HS; Writing-review
and editing, CK and C-SK; Writing-discussion, J-HS, CK and C-SK; Funding
acquisition, C-SK. All authors have read and agreed to the published
version of the manuscript.
References
Ahmad, MQ, M Hassan, A Qayyum, MA Saleem, W Malik, E
Noor, S Ul-Allah (2019). Characterization of synthetic wheat
germplasm using morphological and molecular markers. Intl J Agric Biol 22:131‒138
Avni R, M Nave, O Barad, K
Baruch, SO Twardziok, H Gundlach, I Hale, M Mascher, M Spannagl, K Wiebe, KW
Jordan, G Golan, J Deek, B Ben-Zvi, G Ben-Zvi, A Himmelbach, RP MacLachlan, AG
Sharpe, A Fritz, R Ben-David, H Budak, T Fahima, A Korol, JD Faris, A
Hernandez, MA Mikel, AA Levy, B Steffenson, M Maccaferri, R Tuberosa, L
Cattivelli, T Komatsuda, T Eilam, H Sela, A Sharon, N Ohad, DA Chamovitz, KFX
Mayer, N Stein, G Ronen, Z Peleg, CJ Pozniak, ED Akunov, A Distelfeld (2017).
Wild emmer genome architecture and diversity elucidate wheat evolution and
domestication. Science 357:93‒97
Casebow R, C Hadley, R Uppal, M
Addisu, S Loddo, A Kowalski, S Griffiths, M Gooding (2016).
Reduced height (Rht) alleles affect
wheat grain quality. PLoS One 11; Article e0156056
Chen
M, X She, D Liu, Y Li, C Li (2019). Genetic
diversity between and within Lilium
species and hybrids revealed by ISSR. Intl J Agric Biol 21:1235‒1240
Crawford GW (2011). Advances in
understanding early agriculture in Japan. Curr Anthropol 52:331‒345
Dizkirici
AC, S Onde, M Birsin, M Ozgen, Z Kaya (2013). Phylogenetic
relationships among Triticum L. and Aegilops L. species as genome
progenitors of bread wheat based on sequence diversity in trnT-F region of chloroplast DNA. Genet Resour Evol
60:2227–2240
Dubcovsky J, J Dvorak (2007). Genome plasticity a key factor
in the success of polyploidy wheat under domestication. Science 316:1862‒1866
Ellis MH, W
Spielmeyer, KR Gale, GJ Rebetzke, RA Richards (2002). “Perfect”
markers for the Rht-B1b and Rht-D1b dwarfing genes in wheat.
Theor Appl Genet 105:1038‒1042
Flintham
E, A Borner, A Worland, M Gale (1997). Optimizing wheat grain yield effects of Rht (gibberellin-insensitive)
dwarfing genes. J Agric Sci 128:11‒25
Gale
MD, S Youssefian (1985).
Dwarfing genes in wheat. In: Progress in
Plant Breeding, Vol. 1, pp:1‒35. Russed GE (Ed.). Butterworths, London
Hadzhimateva D, I Avdjieva, E
Todorovska, D Vassilev (2015). A comparative phylogenetic
analysis of hexaploid wheat evolution. J BioSci Biotechnol
2015:31–37
He Q, Y Li, Y Liu, Z Li, S Sun, Q Zhan (2019).
Genetic diversity in the worldwide Alfalfa
germplasm assessed through SSR markers. Intl
J Agric Biol 22:1205‒1210
Hedden P (2003). The genes of
the green revolution. Trends Genet
19:5‒9
Howell SE, MQ
Ahmad, MA Saleem, A Qayyum, S Ul-Allah, E Noor, W Malik, S Mahmood, B Islam (2020).
Population structure, genetic diversity and selection of terminal heat stress
tolerant synthetic derivative wheat genotypes. Intl
J Agric Biol 24:238‒246
Heun M, R Schafer-Pregl, D Klawan, R Castagna, M
Accerbi, B Borghi, F Salamini (1997). Site of einkorn
wheat domestication identified by DNA fingerprinting. Science 278:1312‒1314
IWGSC – International Wheat
Genome Sequencing Consortium
(2014). A chromosome-based
draft sequence of the hexaploid bread wheat (Triticum Aestivum) genome. Science 345; Article 1251788
Jaiswal S, S Sheoran,
V Arora, UB Angadi, MA Iquebal, N Raghav, B Aneja, D Kumar, R Singh, P Sharma,
GP Singh, A Rai, R Tiwari, D Kumar (2017). Putative
microsatellite DNA marker-based wheat genomic resource for varietal improvement
and management. Front Plant Sci 8; Article 2009
Kihara H (1944). Discovery of the DD-analyser, one of the ancestors of Triticum vulgare. Agric Hortic 19:13‒14
Kim M (2013). Wheat in ancient Korea: A size
comparison of carbonized kernels. J Acheaeol Sci 40:517‒525
Lee SI, KC Park, MW Ha, KS Kim, YS
Jang, NS Kim (2012). CACTA transposon-derived Ti-SCARs for cultivar fingerprinting in
rapeseed. Genes Genom 34:575‒579
Liu BH (1998). Statistical genomics: Linkage, Mapping and QTL Analysis. CRC Press,
Boca Raton, Florida,
USA
McFadden, ES, ER
Sears (1946). The origin of Triticum spelta and its free threshing hexaploid relatives. J Hered 37:107‒116
Nesbitt M (1998). Where was einkorn wheat
domesticated? Trends Plant Sci 3:1360‒1385
Petersen G, O Seberg, M Yde, K
Berthelsen (2006). Phylogenetic relationships of Triticum and Aegilops and
evidence for the origin of the A, B, and D genomes of common wheat (Triticum aestivum). Mol Phylogenet Evol 39:70‒82
Rasheed A, W Wen, F Gao, S Zhai, H Jin, J Liu (2016). Development
and validation of KASP assays for functional genes underpinning key economic
traits in wheat. Theor Appl Genet 129:1843‒1860
RDA – Rural
Development Administration (2012). Standard of Research and
Analysis for Agricultural Technology, pp:339‒365.
Embrapa Labex, Korea
Roder MS, J Plaschke,
SU Konig, A Borner, ME Sorells, SD Tanksley, MW Ganal (1995). Abundance, variability and
chromosomal location of microsatellites in wheat. Mol Gen Genet 246:327‒333
Shin SH, KH Kim, JH Son, CS Kang, YK Cheong, CK Lee, JC Park, CS Park (2014).
Analysis of Semi-dwarf gene (Rht) Construction and its relationship with
agricultural characteristics, pre-harvest sprouting, and fusarium head blight
in Korean wheat cultivar. J Agric Life Sci 43:72‒79
Son JH, CH Choi, JB Chun, KH Kim, KM Kim, YJ Kim, JH Park, JW Yang, CS
Kim, CS Kang (2020). Evaluation of
functional markers related to agronomic traits for selecting efficient marker
sets in wheat. Intl J Agric Biol 23:340‒348
Temnykh S, WD Park, N Ayres, S Cartinhour, N Hauck,
L Lipovich, YG Cho, T Ishii, SR McCouch (2000). Mapping
and genome organization of microsatellite sequences in rice (Oryza sativa L.). Theor Appl Genet 100:697‒712
Turuspekov
Y, J Plieske, M Ganal, E Akhunov, S Abugalieva (2015). Phylogenetic analysis of
wheat cultivars in Kazakhstan based on the wheat 90 K single nucleotide
polymorphism array. Plant Genet Resour 15:29‒35
Varshney RK, PC Sharma, PK Gupta, HS Balyan, B Ramesh,
JK Roy, A Kumar, A Sen (1998). Low
level of polymorphism detected by SSR probes in bread wheat. Plant Breed 117:182‒184
Wurschum T, ML Simon, CFH Longin, MR Tucker, WL Leiser (2017). A
modern green revolution gene for reduced height in wheat. Plant J 92:892‒903